Review



slc1a3  (Sangon Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Sangon Biotech slc1a3
    Slc1a3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/apoa1+biotech+ccctgggatcgagtgaagga+f+gcaggtaatcccaaaagcgac+primer+r+sangon/pm41857316-212-3-25
    Average 86 stars, based on 1 article reviews
    slc1a3 - by Bioz Stars, 2026-11
    86/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Astrocytic EAAT1 suppression by EV-ACLY underlies glutamate imbalance and cognitive impairment in POCD.
    Article Snippet: Quantitative PCR was performed using SYBR Green Master Mix (Roche, Cat# 04913914001) on a Roche LightCycler 480 System. .. Primers specific for SLC1A3( 5′‐ ACAGCGTCTAGACCGGTTAGCGCTAGCTCATTAC‐3′ and 5′‐ CGACAGTTAGCCAGAGAGCTCGCGGCCGCCGCTGT‐3′) and GAPDH(5′‐AAC AR TI CL E IN P RE SS TTTGGCATTGTGGAAGG‐3′ and 5′‐ACACATTGGGGGTAGGAACA‐3′) were synthesized by Sangon Biotech. ..

    Article Title: Astrocytic EAAT1 suppression by EV-ACLY underlies glutamate imbalance and cognitive impairment in POCD
    Article Snippet: Quantitative PCR was performed using SYBR Green Master Mix (Roche, Cat# 04913914001) on a Roche LightCycler 480 System. .. Primers specific for SLC1A3 (5′-ACAGCGTCTAGACCGGTTAGCGCTAGCTCATTAC-3′ and 5′-CGACAGTTAGCCAGAGAGCTCGCGGCCGCCGCTGT-3′) and GAPDH (5′-AAC TTTGGCATTGTGGAAGG-3′ and 5′-ACACATTGGGGGTAGGAACA-3′) were synthesized by Sangon Biotech. ..



    Similar Products

    gene exp slc1a3 mm00600697 m1  (Thermo Fisher)
    95
    Thermo Fisher gene exp slc1a3 mm00600697 m1
    Relative expression of genes involved in glutamatergic signaling in the different experimental groups ( n = 4/5 mice per group). The graphs demonstrate the analysis of the relative expression of the genes (A) <t>Glast</t> , (B) Glt1 , (C) Glul , (D) Gria2 . There was no significant difference in the expression of these genes after injury or treatment (one‐way ANOVA followed by Tukey's post‐test; mean ± SEM).
    Gene Exp Slc1a3 Mm00600697 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/Gene+Exp%2E+Slc1a3%2C+Mm00600697_m1/pmc13060370-5-3--1
    Average 95 stars, based on 1 article reviews
    gene exp slc1a3 mm00600697 m1 - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier
    rabbit  (ABclonal Biotechnology)
    94
    ABclonal Biotechnology rabbit
    Relative expression of genes involved in glutamatergic signaling in the different experimental groups ( n = 4/5 mice per group). The graphs demonstrate the analysis of the relative expression of the genes (A) <t>Glast</t> , (B) Glt1 , (C) Glul , (D) Gria2 . There was no significant difference in the expression of these genes after injury or treatment (one‐way ANOVA followed by Tukey's post‐test; mean ± SEM).
    Rabbit, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/SLC1A3+Rabbit+pAb/pmc13074696-84-36-41
    Average 94 stars, based on 1 article reviews
    rabbit - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    slc1a3  (Sangon Biotech)
    86
    Sangon Biotech slc1a3
    Relative expression of genes involved in glutamatergic signaling in the different experimental groups ( n = 4/5 mice per group). The graphs demonstrate the analysis of the relative expression of the genes (A) <t>Glast</t> , (B) Glt1 , (C) Glul , (D) Gria2 . There was no significant difference in the expression of these genes after injury or treatment (one‐way ANOVA followed by Tukey's post‐test; mean ± SEM).
    Slc1a3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/apoa1+biotech+ccctgggatcgagtgaagga+f+gcaggtaatcccaaaagcgac+primer+r+sangon/pm41857316-212-3-25
    Average 86 stars, based on 1 article reviews
    slc1a3 - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    slc1a3 creert females  (Jackson Laboratory)
    86
    Jackson Laboratory slc1a3 creert females
    (A) Establishment of a conditional transgenic approach to activate gene expression in perinatal/postnatal Müller glia <t>using</t> <t>Slc1a3-CreERT</t> driver mice and a Rosa-zsGreen reporter line. (B) 4-OHT treatment of Slc1a3-CreERT;Rosa-zsGreen mice at P5, P7 and P14, followed by analysis of the distribution of zsGreen + cells at P21. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 50µm. (C) Targeting strategy to generate a floxed allele of Plagl1 (from ), and crosses to Slc1a3-CreERT to generate a Müller glia specific Plagl1 -cKO. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/gjcg2ar (D) Tamoxifen injections were administered at P14 every second day and animals were assessed at P21. Sox9 and zsGreen immunostaining in P21 Slc1a3-CreERT ; Rosa-zsGreen control and Slc1a3-CreERT;Plagl1 floxed retinas (i.e., Plagl1 -cKOs). Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 25µm. (E) Total zsGreen + (ZsG + ) and Sox9 + cells were quantified per field. Mean values and error bars representing s.e.m. were plotted. p-values calculated with unpaired t-test.
    Slc1a3 Creert Females, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/creert+fkbp5fl+fl+slc1a3/pmc13016477-307-12-14
    Average 86 stars, based on 1 article reviews
    slc1a3 creert females - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    glast  (Proteintech)
    94
    Proteintech glast
    (A) Establishment of a conditional transgenic approach to activate gene expression in perinatal/postnatal Müller glia <t>using</t> <t>Slc1a3-CreERT</t> driver mice and a Rosa-zsGreen reporter line. (B) 4-OHT treatment of Slc1a3-CreERT;Rosa-zsGreen mice at P5, P7 and P14, followed by analysis of the distribution of zsGreen + cells at P21. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 50µm. (C) Targeting strategy to generate a floxed allele of Plagl1 (from ), and crosses to Slc1a3-CreERT to generate a Müller glia specific Plagl1 -cKO. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/gjcg2ar (D) Tamoxifen injections were administered at P14 every second day and animals were assessed at P21. Sox9 and zsGreen immunostaining in P21 Slc1a3-CreERT ; Rosa-zsGreen control and Slc1a3-CreERT;Plagl1 floxed retinas (i.e., Plagl1 -cKOs). Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 25µm. (E) Total zsGreen + (ZsG + ) and Sox9 + cells were quantified per field. Mean values and error bars representing s.e.m. were plotted. p-values calculated with unpaired t-test.
    Glast, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/SLC1A3+Fusion+Protein/pmc13006427-25-0-2
    Average 94 stars, based on 1 article reviews
    glast - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    addgene cat 72873  (Addgene inc)
    93
    Addgene inc addgene cat 72873
    (A) Establishment of a conditional transgenic approach to activate gene expression in perinatal/postnatal Müller glia <t>using</t> <t>Slc1a3-CreERT</t> driver mice and a Rosa-zsGreen reporter line. (B) 4-OHT treatment of Slc1a3-CreERT;Rosa-zsGreen mice at P5, P7 and P14, followed by analysis of the distribution of zsGreen + cells at P21. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 50µm. (C) Targeting strategy to generate a floxed allele of Plagl1 (from ), and crosses to Slc1a3-CreERT to generate a Müller glia specific Plagl1 -cKO. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/gjcg2ar (D) Tamoxifen injections were administered at P14 every second day and animals were assessed at P21. Sox9 and zsGreen immunostaining in P21 Slc1a3-CreERT ; Rosa-zsGreen control and Slc1a3-CreERT;Plagl1 floxed retinas (i.e., Plagl1 -cKOs). Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 25µm. (E) Total zsGreen + (ZsG + ) and Sox9 + cells were quantified per field. Mean values and error bars representing s.e.m. were plotted. p-values calculated with unpaired t-test.
    Addgene Cat 72873, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/PMXS-SLC1A3+(Plasmid+%2372873)/pm41747732-294-274-274
    Average 93 stars, based on 1 article reviews
    addgene cat 72873 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    gene exp slc1a3 hs00904823 g1  (Thermo Fisher)
    94
    Thermo Fisher gene exp slc1a3 hs00904823 g1
    (A) Establishment of a conditional transgenic approach to activate gene expression in perinatal/postnatal Müller glia <t>using</t> <t>Slc1a3-CreERT</t> driver mice and a Rosa-zsGreen reporter line. (B) 4-OHT treatment of Slc1a3-CreERT;Rosa-zsGreen mice at P5, P7 and P14, followed by analysis of the distribution of zsGreen + cells at P21. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 50µm. (C) Targeting strategy to generate a floxed allele of Plagl1 (from ), and crosses to Slc1a3-CreERT to generate a Müller glia specific Plagl1 -cKO. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/gjcg2ar (D) Tamoxifen injections were administered at P14 every second day and animals were assessed at P21. Sox9 and zsGreen immunostaining in P21 Slc1a3-CreERT ; Rosa-zsGreen control and Slc1a3-CreERT;Plagl1 floxed retinas (i.e., Plagl1 -cKOs). Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 25µm. (E) Total zsGreen + (ZsG + ) and Sox9 + cells were quantified per field. Mean values and error bars representing s.e.m. were plotted. p-values calculated with unpaired t-test.
    Gene Exp Slc1a3 Hs00904823 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc1a3/Gene+Exp%2E+SLC1A3%2C+Hs00904823_g1/pm41787269-101-47-9
    Average 94 stars, based on 1 article reviews
    gene exp slc1a3 hs00904823 g1 - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Relative expression of genes involved in glutamatergic signaling in the different experimental groups ( n = 4/5 mice per group). The graphs demonstrate the analysis of the relative expression of the genes (A) Glast , (B) Glt1 , (C) Glul , (D) Gria2 . There was no significant difference in the expression of these genes after injury or treatment (one‐way ANOVA followed by Tukey's post‐test; mean ± SEM).

    Journal: Journal of Neurochemistry

    Article Title: Targeting Glutamate Excitotoxicity With Memantine Modulates Glial Response and Protects Motoneurons After Spinal Root Lesion

    doi: 10.1111/jnc.70429

    Figure Lengend Snippet: Relative expression of genes involved in glutamatergic signaling in the different experimental groups ( n = 4/5 mice per group). The graphs demonstrate the analysis of the relative expression of the genes (A) Glast , (B) Glt1 , (C) Glul , (D) Gria2 . There was no significant difference in the expression of these genes after injury or treatment (one‐way ANOVA followed by Tukey's post‐test; mean ± SEM).

    Article Snippet: Glast (Slc1a3) , Mm00600697_m1.

    Techniques: Expressing

    (A) Establishment of a conditional transgenic approach to activate gene expression in perinatal/postnatal Müller glia using Slc1a3-CreERT driver mice and a Rosa-zsGreen reporter line. (B) 4-OHT treatment of Slc1a3-CreERT;Rosa-zsGreen mice at P5, P7 and P14, followed by analysis of the distribution of zsGreen + cells at P21. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 50µm. (C) Targeting strategy to generate a floxed allele of Plagl1 (from ), and crosses to Slc1a3-CreERT to generate a Müller glia specific Plagl1 -cKO. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/gjcg2ar (D) Tamoxifen injections were administered at P14 every second day and animals were assessed at P21. Sox9 and zsGreen immunostaining in P21 Slc1a3-CreERT ; Rosa-zsGreen control and Slc1a3-CreERT;Plagl1 floxed retinas (i.e., Plagl1 -cKOs). Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 25µm. (E) Total zsGreen + (ZsG + ) and Sox9 + cells were quantified per field. Mean values and error bars representing s.e.m. were plotted. p-values calculated with unpaired t-test.

    Journal: PLOS Genetics

    Article Title: Plagl1 regulates the retinal progenitor cell to Müller glial cell transition

    doi: 10.1371/journal.pgen.1012020

    Figure Lengend Snippet: (A) Establishment of a conditional transgenic approach to activate gene expression in perinatal/postnatal Müller glia using Slc1a3-CreERT driver mice and a Rosa-zsGreen reporter line. (B) 4-OHT treatment of Slc1a3-CreERT;Rosa-zsGreen mice at P5, P7 and P14, followed by analysis of the distribution of zsGreen + cells at P21. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 50µm. (C) Targeting strategy to generate a floxed allele of Plagl1 (from ), and crosses to Slc1a3-CreERT to generate a Müller glia specific Plagl1 -cKO. Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/gjcg2ar (D) Tamoxifen injections were administered at P14 every second day and animals were assessed at P21. Sox9 and zsGreen immunostaining in P21 Slc1a3-CreERT ; Rosa-zsGreen control and Slc1a3-CreERT;Plagl1 floxed retinas (i.e., Plagl1 -cKOs). Schematics created in BioRender. Schuurmans, C. (2025). https://BioRender.com/n6p34rb . Scale bars: 25µm. (E) Total zsGreen + (ZsG + ) and Sox9 + cells were quantified per field. Mean values and error bars representing s.e.m. were plotted. p-values calculated with unpaired t-test.

    Article Snippet: Plagl1 fl/+ males (received from Pengpeng Bi) [ ] were crossed with Slc1a3-CreERT females (JAX:012586) to generate Plagl1 cKOs.

    Techniques: Transgenic Assay, Gene Expression, Immunostaining, Control